dummy-link

SeqMaker

Next Generation Sequencing Simulation with SNP, Variation and Sequencing Error Integrated

Readme

SeqMaker

Generate simulated sequencing data based on Human Genome Assembly (hg19/hg38), written in Julia language
This tool can be used to test or benchmark bioinformatics algorithms, software or pipelines

Features

  • support sequencing error simulation
  • support SNV simulation
  • support fusion simulation
  • support duplication simulation
  • support single molecule indexing
  • support CNV

Julia

Julia is a fresh programming language with C/C++ like performance and Python like simple usage
On Ubuntu, you can install Julia by sudo apt-get install julia, and type julia to open Julia interactive prompt

Examples

# launch Julia

# clone SeqMaker first
Pkg.clone("https://github.com/OpenGene/SeqMaker.jl.git")

using SeqMaker

# it will download human genome assembly data automatically, please make sure your system can access internet
# ngs(outdir, panel_file, profile_file; depth=0)
# outdir is default to "output"
# panel_file is default to "data/panels/lung_cancer_hg19.bed"
# profile is default to "data/profiles/example.json"

# use all default settings, in this case, depth must be set in the profile.json
ngs()

# set the depth to 100X
ngs(depth=100)

# set the output folder and depth
# depth can be float, like 0.1
ngs("myout", depth=100)

# set the output folder and panel
ngs("myout", "panelfile.bed")

# set the output folder and profile
ngs("myout", "", "profile.json")

# set the output folder, panel and profile
ngs("myout", "panelfile.bed", "profile.json")

# set all parameters
ngs("myout", "panelfile.bed", "profile.json", depth=100)

# simulate whole genome sequencing with a depth of 10x
wgs("myout",  depth=10)

Panel

  • A file describes the regions of your target capturing
  • In bed format, each line is a record
  • If you don't do capturing, you can use a whole genome panel chr9 133588266 133763062 ABL1 chr14 105235686 105262088 AKT1 chr19 40736224 40791443 AKT2 chr2 29415640 30144432 ALK chrX 66764465 66950461 AR chr11 108093211 108239829 ATM chr3 142168077 142297668 ATR chr2 111876955 111926024 BCL2L11 chr7 140419127 140624564 BRAF chr17 41196312 41277500 BRCA1 chr13 32889611 32973805 BRCA2 chr11 69455855 69469242 CCND1 chr12 58141510 58149796 CDK4 chr7 92234235 92465908 CDK6 chr5 149432854 149492935 CSF1R chr1 162601163 162757190 DDR2

Profile

  • A file describes the sequencing simulation config and the mutation to simulate
  • In json format { "config":{ "depth":300, "pair-end":true, "readlen":151, "assembly":"hg19", "seq_error_rate":0.001, "duplication_rate":3.0, "random_index1":false, "random_index2":true, "read1_adapter":"AGATCGGAAGAGCACACGTCTGAACTCCAGTCA", "read2_adapter":"AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT", "template_len":{ "min":130, "max":230 }, "normal_base_qual":{ "min":30, "max":37 }, "seq_error_qual":{ "min":8, "max":20 } }, "fusion":[ { "name":"ALK-intron19-EML4-intron13", "left": { "chrom":"chr2", "strand":"-", "pos":29447873 }, "right": { "chrom":"chr2", "strand":"+", "pos":42526793 }, "rate":0.1 } ], "snv":[ { "name":"EGFR-L861Q", "chrom":"chr7", "pos":55259524, "ref":"T", "alt":"A", "rate":0.2 }, { "name":"KRAS-G12D", "chrom":"chr12", "pos":25398284, "ref":"G", "alt":"A", "rate":0.75 } ], "cnv":[ { "name":"MET-Amplification", "chrom":"chr7", "start":116312406, "end":116438440, "copy":3.0 } ] }

Cite SeqMaker

If you use SeqMaker for your research, you can cite this tool as:

Chen, S., Han, Y., Guo, L., Hu, J., & Gu, J. (2016, December). SeqMaker: A next generation sequencing simulator with variations, sequencing errors and amplification bias integrated. In Bioinformatics and Biomedicine (BIBM), 2016 IEEE International Conference on (pp. 835-840). IEEE.

First Commit

01/14/2016

Last Touched

10 days ago

Commits

75 commits

Used By: